پایان نامه رایگان با موضوع Query، Sbjct، ||، |||||

t identity
Query start position Subject start position
Score = 906 bits (1004), Expect = 0.0
Identities = 575/612 (94%), Gaps = 10/612 (2%)
Strand=Plus/Plus

Query 50 ATAAGCCATCAGAAACAAACGCATACAACGTAACGACAAATCAAGATGGCACAGTAACAT 109
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 4012 ATAAGCCATCAGAAACAAACGCATACAACGTAACGACAAATCAAGATGGCACAGTAACAT 4071

Query 110 ATGGCGCTCGTCCAACACAAAACAAGCCAAGCAAAACAAACGCATATAACGTAACAACAC 169
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct 4072 ATGGCGCTCGTCCAACACAAAACAAGGCAAGCAAAACAAACGCATATAACGTAACAACAC 4131

Query 170 ATGCAAACGGTCAAGTATCATACGGAGCTCGTCCGACATACAAGAAGCCAAGCGAAACGA 229
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 4132 ATGCAAACGGTCAAGTATCATACGGAGCTCGTCCGACATACAAGAAGCCAAGCGAAACGA 4191

Query 230 ATGCATATAACGTAACAACACATGCAAACGGTCAAGTATCATATGGCGCTCGCCCAACAC 289
|||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||
Sbjct 4192 ATGCATATAACGTAACAACACATGCAAACGGTCAAGTATCATATGGCGCTCGTCCGACAC 4251

Query 290 AAAACAAGCCAAGCAAAACAAATGCATACAACGTAACAACACATGCAAATGGCCAAGTAT 349
|||||||| ||||| ||||||||||||||||||||||||||||||||||||| |||||||
Sbjct 4252 AAAACAAGGCAAGCGAAACAAATGCATACAACGTAACAACACATGCAAATGGTCAAGTAT 4311

Query 350 CATATGGCGCTCGCCCGACACAAAACAAGCCAAGCGAAACAAACGCATATAACGTAACAA 409
||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct 4312 CATATGGCGCTCGTCCGACACAAAACAAGCCAAGCAAAACAAACGCATATAACGTAACAA 4371

Query 410 CCAATGCAAATGGCCAAGTATCATACGGAGCTCGCCCGACATACAAGAAGCCAAGCGAAA 469
| | | ||||||||||||||||||||| || ||||||||||||||||||||||||||||
Sbjct 4372 CACACGGAAATGGCCAAGTATCATACGGCGCCCGCCCGACATACAAGAAGCCAAGCGAAA 4431

Query 470 CAAATGCATATAATGTAACAACACATGCAGATGGTACTGCGACATATGGGCCTCGAGCAA 529
|||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| ||
Sbjct 4432 CAAATGCATACAATGTAACAACACATGCAGATGGTACTGCGACATATGGGCCTAGAGTAA 4491

Query 530 CAAAAATAAGTTCTGTAACTCTATCCAAAAGATATACCGTTCAAATACAAAAGCATTATG 589
| |||||||||| ||||||||| ||| ||||| |||| || ||||||||| ||||| |
Sbjct 4492 C-AAAATAAGTT-TGTAACTCTGTCC-AAAGACATACAGT–CAATACAAAA-CATTACG 4545

Query 590 TATCTATACCAACAGGTGATCATGCATTCTATGATGCTTTCTAAATGAATTAAAGCATCG 649
||||| || ||||| || ||||||||||||||||||| |||||| |||||||||||||||
Sbjct 4546 TATCTTTA-CAACA-GTAATCATGCATTCTATGATGC-TTCTAACTGAATTAAAGCATCG 4602

Query 650 TACATTTCGGAA 661
||| ||||||
Sbjct 4603 AACA-ATCGGAA 4613

پيوست 4:
نتايج بلاست سکانس محصول PCR حدود 800 بازي
Basic Local Alignment Search Tool

دیدگاهتان را بنویسید